Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249440

Morpholino Name: elk1 MO1
Synonyms: XtElk-1 MO
Target mRNA: elk1

Morpholino Type: uncategorized morpholino
Sequence: 5' TCCATGACTGCGGGAGCAAAGAGAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 25/25
genome
MO
5' GTCTCTTTGCTCCCGCAGTCATGGA 3'
   |||||||||||||||||||||||||
3' CAGAGAAACGAGGGCGTCAGTACCT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr8:1346737..1346761 25/25 Antisense target elk1
Chr9:19042322..19042346 21/25 Antisense off-target pkd1
Publications
First: Downstream of FGF during mesoderm formation in Xenopus: the roles of Elk-1 and Egr-1., Dev Biol 2009            
Most recent:
View All Papers