Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249441

Morpholino Name: en1 MO1
Synonyms: En1 MO2
Target mRNA: en1

Morpholino Type: uncategorized morpholino
Sequence: 5' TCAGTTTGATCCTCCATGTTATCGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 25/25 22/25
genome
MO
5' GCAGTAACATGGAGGAACAGACTGA 3'
   ||  |||||||||||| || |||||
3' CGCTATTGTACCTCCTAGTTTGACT 5'
5' GCGATAACATGGAGGATCAAACTGA 3'
   |||||||||||||||||||||||||
3' CGCTATTGTACCTCCTAGTTTGACT 5'
5' GCAATAACATGGAGGAACAGACTGA 3'
   || ||||||||||||| || |||||
3' CGCTATTGTACCTCCTAGTTTGACT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:55593851..55593875 25/25 Antisense target en1.L
Chr9_10S:47715142..47715166 22/25 Antisense target en1.S
Chr7S:18837131..18837155 21/25 Antisense off-target actr1a.S
tropicalis 10.0 Chr9:90604037..90604061 21/25 Antisense target en1
Chr7:66581328..66581352 21/25 Sense off-target atp12a
Publications
First: Lymph heart musculature is under distinct developmental control from lymphatic endothelium., Dev Biol 2010          
Most recent:
View All Papers