Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249442

Morpholino Name: en1 MO2
Synonyms: En1 MO1
Target mRNA: en1

Morpholino Type: uncategorized morpholino
Sequence: 5' TGCAGCAGCAAAGTAAGTAGCCCCC 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 25/25 24/25
genome
MO
5' GGGGGCTACTTACTTTGCTGCTGCA 3'
   |||||||||||||||||||||||||
3' CCCCCGATGAATGAAACGACGACGT 5'
5' GGGGGCTACTTACGTTGCTGCTGCA 3'
   ||||||||||||| |||||||||||
3' CCCCCGATGAATGAAACGACGACGT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr9_10L:55593925..55593949 25/25 Antisense target en1.L
Chr9_10S:47715216..47715240 24/25 Antisense target en1.S
Chr8L:70567555..70567579 21/25 Sense off-target axl.L
Chr2L:135952873..135952897 22/25 unknown
Chr2S:121214068..121214092 21/25 unknown
Publications
First: Lymph heart musculature is under distinct developmental control from lymphatic endothelium., Dev Biol 2010          
Most recent:
View All Papers