Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249443

Morpholino Name: en2 MO1
Synonyms: en2-specific morpholino
Target mRNA: en2

Morpholino Type: uncategorized morpholino
Sequence: 5' CATTCTCTTCCATGCTGTTCCCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/23 20/23 22/23
genome
MO
5' GAGTAACAGCATGGAAGAGAATG 3'
   | | |||||||||||||||||||
3' CCCCTTGTCGTACCTTCTCTTAC 5'
5' GAATAACAGCATGGAAGAGAATG 3'
   |   |||||||||||||||||||
3' CCCCTTGTCGTACCTTCTCTTAC 5'
5' GAGGAACAGCATGGAAGAGAATG 3'
   | |||||||||||||||||||||
3' CCCCTTGTCGTACCTTCTCTTAC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6S:10913730..10913752 22/23 Antisense target en2.S
Chr6L:15296878..15296900 20/23 Antisense target en2.L
Chr7L:124945030..124945052 20/23 Antisense off-target cadm4.L
Chr1S:63608843..63608865 20/23 Antisense off-target tspan5.S
Chr1S:68026154..68026176 20/23 Antisense off-target fam13a.S
Chr5L:58921830..58921852 20/23 Antisense off-target LOC101027285
Chr8S:39924172..39924194 19/23 Antisense off-target pbx3.S
Chr9_10L:116882030..116882052 19/23 Antisense off-target tfap4.L
Chr1L:219598024..219598046 19/23 Sense off-target atp8b1.L
Chr5L:69788669..69788691 19/23 Sense off-target trmt11.L
Chr7L:2169116..2169138 19/23 Sense off-target tcf7l2.L
Chr4L:121035224..121035246 19/23 Antisense off-target cdc42ep1.L
Chr2L:15754773..15754795 19/23 Sense off-target LOC108707425
Chr5L:10945392..10945414 19/23 Antisense off-target LOC108716440
Chr4L:30095329..30095351 19/23 Antisense off-target LOC108713626
Chr4L:30147330..30147352 19/23 Antisense off-target LOC121402976
Chr2S:45251313..45251335 21/23 unknown
Chr3S:84773233..84773255 21/23 unknown
Chr7S:25450553..25450575 20/23 unknown
Chr1L:131716369..131716391 19/23 unknown
Chr1S:13244195..13244217 19/23 unknown
Chr2L:190410822..190410844 19/23 unknown
Chr4S:7496677..7496699 19/23 unknown
tropicalis 10.0 Chr6:16787144..16787166 21/23 Antisense target en2
Chr2:16231673..16231695 20/23 Sense off-target grik1
Chr6:125578492..125578514 20/23 Antisense off-target cpne3
Chr1:129524928..129524950 19/23 Sense off-target apba1
Chr3:21433280..21433302 19/23 Antisense off-target hmgxb3
Chr5:67340956..67340978 19/23 Sense off-target trmt11
Chr7:49754544..49754566 19/23 Antisense off-target LOC105947760
Chr7:49754544..49754566 19/23 Sense off-target LOC116412279
Chr7:49744727..49744749 19/23 Antisense off-target LOC105947760
Chr7:49744727..49744749 19/23 Sense off-target LOC108648205
Chr8:47971654..47971676 20/23 unknown
Chr4:73273059..73273081 19/23 unknown
Chr7:49770882..49770904 19/23 unknown
Chr7:49792514..49792536 19/23 unknown
Chr7:49734546..49734568 19/23 unknown
Publications
First: En2, Pax2/5 and Tcf-4 transcription factors cooperate in patterning the Xenopus brain., Dev Biol 2010                    
Most recent:
View All Papers