Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249444

Morpholino Name: enah MO1
Synonyms: Xena MO2
Target mRNA: enah

Morpholino Type: uncategorized morpholino
Sequence: 5' TGTGTCTCACTTTGCTCCTCCCCCG 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 23/25 25/25
genome
MO
5' CGGGGGAGGCGGAAAGTGAGACACA 3'
   ||||||||| | |||||||||||||
3' GCCCCCTCCTCGTTTCACTCTGTGT 5'
5' CGGGGGAGGAGCAAAGTGAGACACA 3'
   |||||||||||||||||||||||||
3' GCCCCCTCCTCGTTTCACTCTGTGT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5S:12388849..12388873 25/25 Antisense target enah.S
Chr5L:17700422..17700446 23/25 Antisense target enah.L
tropicalis 10.0 Chr3:141023751..141023775 21/25 Sense off-target il27ra
Chr4:151975020..151975044 21/25 unknown
Publications
First: Enabled (Xena) regulates neural plate morphogenesis, apical constriction, and cellular adhesion required for neural tube closure in Xenopus., Dev Biol 2008              
Most recent:
View All Papers