Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249445

Morpholino Name: enah MO2
Synonyms: Xena sMO
Target mRNA: enah

Morpholino Type: uncategorized morpholino
Sequence: 5' CACAAACCCATACCTGGTGATCCT 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 24/24
genome
MO
5' AGGATCACCAGGTATGGGTTTGTG 3'
   ||||||||||||||||||||||||
3' TCCTAGTGGTCCATACCCAAACAC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5S:12423942..12423965 24/24 Antisense target enah.S
Chr1L:206336951..206336974 20/24 unknown
Chr2L:129402634..129402657 20/24 unknown
Chr2S:114597659..114597682 20/24 unknown
Chr3L:33348672..33348695 20/24 unknown
Chr4L:19385935..19385958 20/24 unknown
Chr4S:47840349..47840372 20/24 unknown
Chr8S:24376559..24376582 20/24 unknown
Chr8S:63930536..63930559 20/24 unknown
tropicalis 10.0 Chr8:102446624..102446647 20/24 unknown
Publications
First: Enabled (Xena) regulates neural plate morphogenesis, apical constriction, and cellular adhesion required for neural tube closure in Xenopus., Dev Biol 2008              
Most recent:
View All Papers