Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249486

Morpholino Name: fbxo43 MO1
Synonyms: EMI2, Emi2 MO, Erp1, Erp1 antisense MO, Xerp1 MO1
Target mRNA: fbxo43

Morpholino Type: uncategorized morpholino
Sequence: 5' AGATTTGCCATCTCTTGTTTCTT 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 23/23 20/23
genome
MO
5' AAGAAACAAGAGATGGCAAATCT 3'
   |||||||||||||||||||||||
3' TTCTTTGTTCTCTACCGTTTAGA 5'
5' AAGAAACAAGAGATGGCACACCG 3'
   |||||||||||||||||| | | 
3' TTCTTTGTTCTCTACCGTTTAGA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:138137758..138137780 23/23 Antisense target fbxo43.L
Chr6S:113992204..113992226 20/23 Antisense target fbxo43.S
Chr5L:112037959..112037981 21/23 Antisense off-target fgf12.L
Chr3L:81124330..81124352 20/23 Antisense off-target trmu.L
Chr2S:142690274..142690296 20/23 Antisense off-target nhlrc3.S
Chr9_10L:50022636..50022658 20/23 Sense off-target adprm.2.L
Chr3L:123544000..123544022 19/23 Antisense off-target megf11.L
Chr8L:106900564..106900586 19/23 Antisense off-target pla2g4f.L
Chr1S:62478858..62478880 19/23 Sense off-target slc39a8.S
Chr2S:76732674..76732696 20/23 unknown
Chr7S:7401427..7401449 20/23 unknown
Chr7S:99857510..99857532 20/23 unknown
Chr7S:62045082..62045104 19/23 unknown
tropicalis 10.0 Chr1:12154500..12154522 20/23 Sense off-target rnf24
Chr1:31792175..31792197 20/23 Sense off-target anapc4
Chr5:28416470..28416492 20/23 Sense off-target macrod2
Chr5:128445828..128445850 19/23 Sense off-target rbp2
Chr1:78486754..78486776 19/23 Sense off-target snca
Chr2:144535184..144535206 19/23 Antisense off-target endou
Chr2:144535184..144535206 19/23 Sense off-target tespa1
Chr6:13786940..13786962 20/23 unknown
Chr2:14962991..14963013 19/23 unknown
Chr3:46031928..46031950 19/23 unknown
Chr9:35443315..35443337 19/23 unknown
Publications
First: Erp1/Emi2 is essential for the meiosis I to meiosis II transition in Xenopus oocytes., Dev Biol 2007          
Most recent: The APC/C inhibitor XErp1/Emi2 is essential for Xenopus early embryonic divisions., Science 2012  
View All Papers