Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249487

Morpholino Name: fbxo43 MO2
Synonyms: EMI2, Erp1, Xerp1 MO2
Target mRNA: fbxo43

Morpholino Type: uncategorized morpholino
Sequence: 5' TGTGCCATCTCTTGTTTCTTTCTTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 24/25 25/25
genome
MO
5' GAAGAAAGAAGCAAGAGATGGCACA 3'
   |||||||||| ||||||||||||||
3' CTTCTTTCTTTGTTCTCTACCGTGT 5'
5' GAAGAAAGAAACAAGAGATGGCAAA 3'
   ||||||||||||||||||||||| |
3' CTTCTTTCTTTGTTCTCTACCGTGT 5'
5' GAAGAAAGAAACAAGAGATGGCACA 3'
   |||||||||||||||||||||||||
3' CTTCTTTCTTTGTTCTCTACCGTGT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6S:113992207..113992231 25/25 Antisense target fbxo43.S
Chr6L:138137761..138137785 24/25 Antisense target fbxo43.L
Chr9_10L:50022639..50022663 22/25 Sense off-target adprm.2.L
Chr5L:112037962..112037986 21/25 Antisense off-target fgf12.L
Chr9_10L:47920703..47920727 21/25 Sense off-target rhbdf2.L
Chr6S:92497503..92497527 21/25 Sense off-target epb41l1.S
Chr1S:111864767..111864791 21/25 Sense off-target LOC108706385
Chr7S:49817784..49817808 21/25 Antisense off-target LOC121396364
Chr3S:114328984..114329008 22/25 unknown
Chr2S:110165634..110165658 21/25 unknown
Chr3L:158145854..158145878 21/25 unknown
Chr4L:5843709..5843733 21/25 unknown
Chr9_10S:58561477..58561501 21/25 unknown
Chr4L:70130822..70130846 21/25 unknown
Chr7S:34182544..34182568 21/25 unknown
tropicalis 10.0 Chr6:128124312..128124336 24/25 Antisense target fbxo43
Chr2:77240790..77240814 21/25 unknown
Chr4:78637312..78637336 21/25 unknown
Publications
First: Erp1/Emi2 is essential for the meiosis I to meiosis II transition in Xenopus oocytes., Dev Biol 2007          
Most recent: The APC/C inhibitor XErp1/Emi2 is essential for Xenopus early embryonic divisions., Science 2012  
View All Papers