Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249491

Morpholino Name: fbxo43 MO6
Synonyms: XErp1#5
Target mRNA: fbxo43

Morpholino Type: uncategorized morpholino
Sequence: 5' CGAAGGGACTTTTCCCGGCC 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 20/20 20/20
genome
MO
5' GGCCGGGAAAAGTCCCTTCG 3'
   ||||||||||||||||||||
3' CCGGCCCTTTTCAGGGAAGC 5'
5' GGCCGGGAAAAGTCCCTTCG 3'
   ||||||||||||||||||||
3' CCGGCCCTTTTCAGGGAAGC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:138137347..138137366 20/20 Antisense target fbxo43.L
Chr6S:113991778..113991797 20/20 Antisense target fbxo43.S
Chr6L:149442636..149442655 17/20 unknown
tropicalis 10.0 Chr4:145846792..145846811 18/20 Sense off-target c4h3orf14
Chr5:50697246..50697265 17/20 unknown
Publications
First: Erp1/Emi2 is essential for the meiosis I to meiosis II transition in Xenopus oocytes., Dev Biol 2007          
Most recent:
View All Papers