Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249493

Morpholino Name: fbxo43 MO8
Synonyms: XErp1#7
Target mRNA: fbxo43

Morpholino Type: uncategorized morpholino
Sequence: 5' TTTATTGGAGACAGTATCAA 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 20/20 20/20
genome
MO
5' TTGATACTGTCTCCAATAAA 3'
   ||||||||||||||||||||
3' AACTATGACAGAGGTTATTT 5'
5' TTGATACTGTCTCCAATAAA 3'
   ||||||||||||||||||||
3' AACTATGACAGAGGTTATTT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:138137542..138137561 20/20 Antisense target fbxo43.L
Chr6S:113991973..113991992 20/20 Antisense target fbxo43.S
Chr3S:77799437..77799456 18/20 Antisense off-target grm8.S
Chr9_10L:100941862..100941881 18/20 Sense off-target shisa9.L
Chr4L:75812442..75812461 18/20 Antisense off-target slc44a5.L
Chr8S:11835034..11835053 18/20 Sense off-target ppp2r5c.S
Chr1S:133009744..133009763 17/20 Antisense off-target LOC108707052
Chr2L:24822028..24822047 17/20 Sense off-target LOC108707903
Chr3S:94964808..94964827 17/20 Antisense off-target LOC108712382
Chr7L:80168331..80168350 16/20 Antisense off-target grik4.L
Chr9_10L:112016951..112016970 18/20 unknown
Chr1S:56410168..56410187 17/20 unknown
Chr7S:23524163..23524182 16/20 unknown
Chr8L:52121315..52121334 16/20 unknown
tropicalis 10.0 Chr7:78502757..78502776 16/20 Antisense off-target grik4
Chr7:28555063..28555082 16/20 Sense off-target calhm2
Chr2:174780979..174780998 16/20 Sense off-target LOC116406442
Publications
First: Erp1/Emi2 is essential for the meiosis I to meiosis II transition in Xenopus oocytes., Dev Biol 2007          
Most recent:
View All Papers