Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249511

Morpholino Name: vegfd MO1
Synonyms: figf MO1, xVEGF-D
Target mRNA: vegfd

Morpholino Type: uncategorized morpholino
Sequence: 5' GCCCACGGTCTAATCATATTGGTAG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 24/25 25/25
genome
MO
5' GTACCAATATGATTAGACCGTGGGC 3'
    ||||||||||||||||||||||||
3' GATGGTTATACTAATCTGGCACCCG 5'
5' CTACCAATATGATTAGACCGTGGGC 3'
   |||||||||||||||||||||||||
3' GATGGTTATACTAATCTGGCACCCG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:28425586..28425610 25/25 Antisense target vegfd.L
Chr6L:43759228..43759252 21/25 Sense off-target tax1bp1.L
tropicalis 10.0 Chr2:29720061..29720085 24/25 Antisense target vegfd
Publications
First: Role of VEGF-D and VEGFR-3 in developmental lymphangiogenesis, a chemicogenetic study in Xenopus tadpoles., Blood 2008  
Most recent:
View All Papers