Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249623

Morpholino Name: gdf6 MO1
Synonyms: GDF6 MO, GDF6-MO
Target mRNA: gdf6

Morpholino Type: uncategorized morpholino
Sequence: 5' GCAGAGGGCTCCTGTATGTATCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 24/25 25/25
genome
MO
5' ATGGATACATACAGGAGCCCCCTGC 3'
   |||||||||||||||||||| ||||
3' TACCTATGTATGTCCTCGGGAGACG 5'
5' ATGGATACATACAGGAGCCCTCTGC 3'
   |||||||||||||||||||||||||
3' TACCTATGTATGTCCTCGGGAGACG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6S:116415791..116415815 25/25 Antisense target gdf6.S
Chr6L:140573083..140573107 24/25 Antisense off-target LOC108719358
Chr6L:91080855..91080879 22/25 Antisense off-target gmds.L
Chr3L:145666352..145666376 22/25 Antisense off-target LOC121401626
Chr1L:161588274..161588298 22/25 unknown
Chr1L:57116702..57116726 21/25 unknown
Chr2S:112319091..112319115 21/25 unknown
Chr6L:91697125..91697149 21/25 unknown
tropicalis 10.0 Chr6:130144704..130144728 24/25 Antisense target gdf6
Publications
First: Twisted gastrulation loss-of-function analyses support its role as a BMP inhibitor during early Xenopus embryogenesis., Development 2003                
Most recent: Eye and neural defects associated with loss of GDF6., BMC Dev Biol 2006            
View All Papers