Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249666

Morpholino Name: h3-3a MO3
Synonyms: H3.3, h3f3a MO3
Target mRNA: h3-3a

Morpholino Type: translation blocking morpholino
Sequence: 5' GGTCTGCTTTGTACGGGCCATTTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis
Identities 23/25
genome
MO
5' GGAAATGGCCCGTACCAAGCAGACA 3'
   ||||||||||||||| |||||||| 
3' CCTTTACCGGGCATGTTTCGTCTGG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5S:12195928..12195952 25/25 Antisense off-target h3-5.L
Chr5L:17923210..17923234 23/25 Antisense off-target LOC108716488
Chr9_10S:94026060..94026084 21/25 Antisense off-target h3c13.S
Chr9_10S:71021938..71021962 21/25 Sense off-target itprid2.S
Chr9_10L:107985153..107985177 21/25 Antisense off-target LOC108701569
Chr3S:123467854..123467878 21/25 unknown
Chr9_10L:133833222..133833246 21/25 unknown
Chr9_10L:134263732..134263756 21/25 unknown
Chr9_10L:135043477..135043501 21/25 unknown
tropicalis 10.0 Chr5:8209996..8210020 23/25 Antisense target h3-3a
Chr9:3506190..3506214 22/25 Sense off-target h2ac14
Chr9:2965517..2965541 22/25 Antisense off-target LOC100486653
Chr9:2989985..2990009 22/25 Antisense off-target LOC100486653
Chr9:2989985..2990009 22/25 Sense off-target LOC100493706
Chr9:3506190..3506214 22/25 Sense off-target LOC105945443
Chr9:3506190..3506214 22/25 Antisense off-target LOC101730986
Chr9:4894196..4894220 21/25 Sense off-target h2aj
Chr3:135234032..135234056 21/25 Antisense off-target h3c14
Chr10:44806669..44806693 21/25 Antisense off-target h3-3b
Chr9:2727438..2727462 21/25 Antisense off-target h3c13
Chr3:135383980..135384004 21/25 Sense off-target LOC100493093
Chr3:135383980..135384004 21/25 Antisense off-target LOC108646287
Chr3:135396651..135396675 21/25 Antisense off-target LOC116409810
Chr3:135488061..135488085 21/25 Sense off-target LOC101734776
Chr3:135488061..135488085 21/25 Antisense off-target LOC108646286
Chr6:4852645..4852669 21/25 Sense off-target LOC101733242
Chr6:5109905..5109929 21/25 Antisense off-target LOC100497127
Chr6:5269748..5269772 21/25 Antisense off-target LOC116411629
Chr3:135506145..135506169 21/25 Antisense off-target LOC100496129
Chr3:135612777..135612801 21/25 Antisense off-target LOC116409812
Chr3:135618393..135618417 21/25 Antisense off-target LOC116409811
Chr3:135653766..135653790 21/25 Antisense off-target LOC100495338
Chr3:135661764..135661788 21/25 Antisense off-target LOC100493041
Chr3:135763486..135763510 21/25 Antisense off-target LOC100495788
Chr6:4059550..4059574 21/25 Sense off-target LOC101734931
Chr6:4059550..4059574 21/25 Antisense off-target LOC101732029
Chr6:4245940..4245964 21/25 Antisense off-target LOC100487139
Chr6:4252505..4252529 21/25 Antisense off-target LOC100496027
Chr6:4308188..4308212 21/25 Antisense off-target LOC100486720
Chr6:4852645..4852669 21/25 Antisense off-target LOC116411630
Chr9:2677794..2677818 21/25 Antisense off-target LOC101731074
Chr9:2727438..2727462 21/25 Antisense off-target LOC100488698
Chr9:2833101..2833125 21/25 Sense off-target LOC101731959
Chr6:5288981..5289005 21/25 Antisense off-target LOC100493100
Chr9:2833101..2833125 21/25 Antisense off-target LOC108648869
Chr9:2891951..2891975 21/25 Antisense off-target LOC100493036
Chr9:2954383..2954407 21/25 Sense off-target LOC116407589
Chr9:2954383..2954407 21/25 Antisense off-target LOC100494884
Chr9:4257125..4257149 21/25 Antisense off-target LOC116406473
Chr9:4565865..4565889 21/25 Antisense off-target LOC100485665
Chr9:4578575..4578599 21/25 Antisense off-target LOC105947137
Chr9:4747342..4747366 21/25 Antisense off-target LOC100487628
Chr9:4747342..4747366 21/25 Antisense off-target LOC116406469
Chr9:4803197..4803221 21/25 Sense off-target LOC100487628
Chr9:4803197..4803221 21/25 Antisense off-target LOC108645245
Chr9:4807104..4807128 21/25 Sense off-target LOC100487628
Chr9:4807104..4807128 21/25 Antisense off-target LOC101733224
Chr9:4894196..4894220 21/25 Antisense off-target LOC101730415
Chr9:4910107..4910131 21/25 Antisense off-target LOC116407578
Chr9:4974892..4974916 21/25 Sense off-target LOC100497614
Chr9:4974892..4974916 21/25 Antisense off-target LOC116407579
Chr9:4988963..4988987 21/25 Sense off-target LOC100497614
Chr9:5024642..5024666 21/25 Antisense off-target LOC101730642
Chr9:5558098..5558122 21/25 Antisense off-target LOC100497406
Chr9:5608824..5608848 21/25 Sense off-target LOC116407737
Chr9:5608824..5608848 21/25 Antisense off-target LOC116407634
Chr9:5615682..5615706 21/25 Antisense off-target LOC116407634
Chr3:135252764..135252788 21/25 unknown
Chr9:2809832..2809856 21/25 unknown
Chr9:2819323..2819347 21/25 unknown
Chr9:4262075..4262099 21/25 unknown
Chr9:5010741..5010765 21/25 unknown
Publications
First: A developmental requirement for HIRA-dependent H3.3 deposition revealed at gastrulation in Xenopus., Cell Rep 2012                                        
Most recent: Histone variant H3.3 residue S31 is essential for Xenopus gastrulation regardless of the deposition pathway., Nat Commun 2020                  
View All Papers