Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249667

Morpholino Name: hand2 MO1
Synonyms: Hand2 MO
Target mRNA: hand2

Morpholino Type: uncategorized morpholino
Sequence: 5' CCCCAACCAGACTCATCTCAGCTAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 24/25
genome
MO
5' CCAGCTGACATGAGTCTGGTTGGGG 3'
     |||||| ||||||||||||||||
3' CATCGACTCTACTCAGACCAACCCC 5'
5' GTAGCTGAGATGAGTCTGGTTGGGG 3'
   |||||||||||||||||||||||||
3' CATCGACTCTACTCAGACCAACCCC 5'
5' GTAGCTGACATGAGTCTGGTTGGGG 3'
   |||||||| ||||||||||||||||
3' CATCGACTCTACTCAGACCAACCCC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1L:51408920..51408944 25/25 Antisense target hand2.L
Chr1S:37687032..37687056 24/25 Antisense target hand2.S
Chr3S:6442999..6443023 21/25 Sense off-target tspan11.S
Chr3S:6443053..6443077 21/25 Sense off-target tspan11.S
Chr3S:6443071..6443095 21/25 Sense off-target tspan11.S
Chr3S:6443089..6443113 21/25 Sense off-target tspan11.S
tropicalis 10.0 Chr1:48657388..48657412 22/25 Antisense target hand2
Publications
First: Xenopus zinc finger transcription factor IA1 (Insm1) expression marks anteroventral noradrenergic neuron progenitors in Xenopus embryos., Dev Dyn 2008            
Most recent: Ascl1 as a novel player in the Ptf1a transcriptional network for GABAergic cell specification in the retina., PLoS One 2014                          
View All Papers