Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249668

Morpholino Name: hapln3 MO1
Synonyms: XHAPLN3-MO
Target mRNA: hapln3

Morpholino Type: uncategorized morpholino
Sequence: 5' ATCACAGCAAATTCGGCAAGCATTG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' CAATGCTTGCCGAATTTGCTGTGAT 3'
   |||||||||||||||||||||||||
3' GTTACGAACGGCTTAAACGACACTA 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:115723860..115723884 25/25 Antisense target hapln3.L
Chr1S:140217139..140217163 21/25 Antisense off-target rtn4r.S
Chr1L:38601542..38601566 21/25 unknown
Publications
First: XHAPLN3 plays a key role in cardiogenesis by maintaining the hyaluronan matrix around heart anlage., Dev Biol 2008                            
Most recent:
View All Papers