Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249670

Morpholino Name: has1 MO2
Synonyms: Has1-Mo2, xHas-1
Target mRNA: has1

Morpholino Type: uncategorized morpholino
Sequence: 5' GTTGCCGAATGAAGAGGCCCCAAGA 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' TCTTGGGGCCTCTTCATTCGGCAAC 3'
   |||||||||||||||||||||||||
3' AGAACCCCGGAGAAGTAAGCCGTTG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:1590722..1590746 25/25 Antisense target has1.S
Publications
First: Hyaluronan is required for cranial neural crest cells migration and craniofacial development., Dev Dyn 2012                
Most recent: Cell contacts and pericellular matrix in the Xenopus gastrula chordamesoderm., PLoS One 2024                    
View All Papers