Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249671

Morpholino Name: has2 MO1
Synonyms: Has2 MO 1, XHas2-Mo1
Target mRNA: has2

Morpholino Type: uncategorized morpholino
Sequence: 5' GTTATTGCCTTGGTCCTGTGGTCAC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 24/25 25/25
genome
MO
5' GTGACCATAGGACCAAGGCAATAAC 3'
   ||||||| |||||||||||||||||
3' CACTGGTGTCCTGGTTCCGTTATTG 5'
5' GTGACCACAGGACCAAGGCAATAAC 3'
   |||||||||||||||||||||||||
3' CACTGGTGTCCTGGTTCCGTTATTG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6S:125248006..125248030 25/25 Antisense target has2.S
Chr6S:97170629..97170653 21/25 Antisense off-target dsc3.S
Chr5S:87254250..87254274 21/25 unknown
Chr7L:86830760..86830784 21/25 unknown
tropicalis 10.0 Chr6:139323083..139323107 24/25 Antisense target has2
Chr5:27921280..27921304 21/25 unknown
Publications
First: XHas2 activity is required during somitogenesis and precursor cell migration in Xenopus development., Development 2006                          
Most recent: Hyaluronan is required for cranial neural crest cells migration and craniofacial development., Dev Dyn 2012                
View All Papers