Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249672

Morpholino Name: has2 MO2
Synonyms: Has2 MO 2, XHas2-Mo2, Xhas2 MO2
Target mRNA: has2

Morpholino Type: uncategorized morpholino
Sequence: 5' TGCATATAAACCGTTCACAGTGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' ATGCACTGTGAACGGTTTATATGCA 3'
   |||||||||||||||||||||||||
3' TACGTGACACTTGCCAAATATACGT 5'
5' ATGCACTGTGAACGGTTTATATGCA 3'
   |||||||||||||||||||||||||
3' TACGTGACACTTGCCAAATATACGT 5'
5' ATGCACTGTGAACGGTTTATATGCA 3'
   |||||||||||||||||||||||||
3' TACGTGACACTTGCCAAATATACGT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:150171789..150171813 25/25 Antisense target has2.L
Chr6S:125254682..125254706 25/25 Antisense target has2.S
tropicalis 10.0 Chr6:139329519..139329543 25/25 Antisense target has2
Chr4:141890826..141890850 21/25 Antisense off-target lmod3
Publications
First: XHas2 activity is required during somitogenesis and precursor cell migration in Xenopus development., Development 2006                          
Most recent: Cell contacts and pericellular matrix in the Xenopus gastrula chordamesoderm., PLoS One 2024                    
View All Papers