Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249673

Morpholino Name: has2 MO3
Synonyms: Xhas2-MO
Target mRNA: has2

Morpholino Type: uncategorized morpholino
Sequence: 5' ATAAACCGTTCACAGTGCATCTTGG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 22/25 22/25
genome
MO
5' TGCAGATGCACTGTGAACGGTTTAT 3'
      ||||||||||||||||||||||
3' GGTTCTACGTGACACTTGCCAAATA 5'
5' TGCAGATGCACTGTGAACGGTTTAT 3'
      ||||||||||||||||||||||
3' GGTTCTACGTGACACTTGCCAAATA 5'
5' TGTAGATGCACTGTGAACGGTTTAT 3'
      ||||||||||||||||||||||
3' GGTTCTACGTGACACTTGCCAAATA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:150171784..150171808 22/25 Antisense target has2.L
Chr6S:125254677..125254701 22/25 Antisense target has2.S
Chr8S:77463415..77463439 21/25 Antisense off-target LOC108700181
tropicalis 10.0 Chr6:139329514..139329538 22/25 Antisense target has2
Chr2:17935113..17935137 22/25 Sense off-target adamts5
Publications
First: XHAPLN3 plays a key role in cardiogenesis by maintaining the hyaluronan matrix around heart anlage., Dev Biol 2008                            
Most recent:
View All Papers