Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249674

Morpholino Name: hes1 MO1
Synonyms: hairy MIR9 target protector, hairy1 target protector morpholino
Target mRNA: hes1

Morpholino Type: uncategorized morpholino
Sequence: 5' AAGAGCATTCCATGTCTTTGGCATC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 24/25
genome
MO
5' GATGCCAAAGACATGGAATGCTCTT 3'
   |||||||||||||||||||||||||
3' CTACGGTTTCTGTACCTTACGAGAA 5'
5' GATGCCAAAGACATGGAATGCTCTT 3'
   |||||||||||||||||||||||||
3' CTACGGTTTCTGTACCTTACGAGAA 5'
5' TATGCCAAAGACATGGAATGCTCTT 3'
    ||||||||||||||||||||||||
3' CTACGGTTTCTGTACCTTACGAGAA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:113862565..113862589 25/25 Antisense target hes1.L
Chr5S:93348637..93348661 24/25 Antisense target hes1.S
Chr6S:83730586..83730610 22/25 Antisense off-target ctdp1.S
Chr6L:102952220..102952244 21/25 Antisense off-target ctdp1.L
tropicalis 10.0 Chr5:106987526..106987550 25/25 Antisense target hes1
Chr7:22972311..22972335 21/25 unknown
Publications
First: MicroRNA-9 reveals regional diversity of neural progenitors along the anterior-posterior axis., Dev Cell 2011                
Most recent:
View All Papers