Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249679

Morpholino Name: hes4 MO3
Synonyms: Xhairy2a mo, h2A mo
Target mRNA: hes4

Morpholino Type: uncategorized morpholino
Sequence: 5' GCATGTTCAGTTGCTGGTACAGTCA 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' TGACTGTACCAGCAACTGAACATGC 3'
   |||||||||||||||||||||||||
3' ACTGACATGGTCGTTGACTTGTACG 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:77144919..77144943 25/25 Antisense target hes4.S
Chr1S:152666015..152666039 22/25 unknown
tropicalis 10.0 Chr7:70169176..70169200 21/25 Sense off-target zbtb44
Chr1:193287841..193287865 21/25 unknown
Publications
First: Two alloalleles of Xenopus laevis hairy2 gene--evolution of duplicated gene function from a developmental perspective., Dev Genes Evol 2007  
Most recent: Xhairy2 functions in Xenopus lens development by regulating p27(xic1) expression., Dev Dyn 2009                
View All Papers