Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249680

Morpholino Name: hes4 MO4
Synonyms: Xhairy2b mo, h2B mo
Target mRNA: hes4

Morpholino Type: uncategorized morpholino
Sequence: 5' CGGATAGGGCTAGTGATGCGGATGT 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' ACATCCGCATCACTAGCCCTATCCG 3'
   |||||||||||||||||||||||||
3' TGTAGGCGTAGTGATCGGGATAGGC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:90956827..90956851 25/25 Antisense target hes4.L
Chr3L:144107567..144107591 25/25 Sense off-target gipc1.L
Chr1S:197205171..197205195 25/25 unknown
Publications
First: Xenopus hairy2b specifies anterior prechordal mesoderm identity within Spemann's organizer., Dev Dyn 2005            
Most recent: An intact brachyury function is necessary to prevent spurious axial development in Xenopus laevis., PLoS One 2013                                        
View All Papers