Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249682

Morpholino Name: hes6.1 MO1
Synonyms: MO1, Xhes6 MO-1
Target mRNA: hes6.1

Morpholino Type: uncategorized morpholino
Sequence: 5' TCTGCCTGCGCTCCATGTGATTGTT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 21/25 25/25 22/25
genome
MO
5' AGCGATCAGATGGAGCGCAGGGAGA 3'
   | | |||| |||||||||||| |||
3' TTGTTAGTGTACCTCGCGTCCGTCT 5'
5' AACAATCACATGGAGCGCAGGCAGA 3'
   |||||||||||||||||||||||||
3' TTGTTAGTGTACCTCGCGTCCGTCT 5'
5' AACCATCACATGGAGCGCACGGAGA 3'
   ||| ||||||||||||||| | |||
3' TTGTTAGTGTACCTCGCGTCCGTCT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5L:137645944..137645968 25/25 Antisense target hes6.1.L
Chr5S:115544750..115544774 22/25 Antisense target hes6.1.S
tropicalis 10.0 Chr5:128043066..128043090 21/25 Antisense target hes6.1
Publications
First: Hes6 is required for MyoD induction during gastrulation., Dev Biol 2007              
Most recent: Hes6 is required for the neurogenic activity of neurogenin and NeuroD., PLoS One 2011                
View All Papers