Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249685

Morpholino Name: hes7.1 MO2
Synonyms: XHR1-MO2
Target mRNA: hes7.1

Morpholino Type: uncategorized morpholino
Sequence: 5' GGTAAGATGATGATGATGATGAAGA 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: Identification of target genes for the Xenopus Hes-related protein XHR1, a prepattern factor specifying the midbrain-hindbrain boundary., Dev Biol 2005                      
Most recent:
View All Papers