Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249696

Morpholino Name: hhex MO1
Synonyms: XHex MO, hex
Target mRNA: hhex

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' GGTGCTGGTACTGCATGTCGATTCC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 25/25 22/25
genome
MO
5' AGAATAGCCATGCAGTACCAGCACC 3'
    |||| | |||||||||||||||||
3' CCTTAGCTGTACGTCATGGTCGTGG 5'
5' GGAATCGACATGCAGTACCAGCACC 3'
   |||||||||||||||||||||||||
3' CCTTAGCTGTACGTCATGGTCGTGG 5'
5' GGAATCATCATGCAGTACCAGCAGC 3'
   ||||||  ||||||||||||||| |
3' CCTTAGCTGTACGTCATGGTCGTGG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:20351394..20351418 25/25 Antisense target hhex.L
Chr7S:15902536..15902560 22/25 Antisense target hhex.S
Chr5L:31819328..31819352 21/25 Sense off-target ehbp1.L
Chr7L:108164182..108164206 21/25 Antisense off-target LOC108695878
Chr8L:28939227..28939251 21/25 Antisense off-target LOC121396947
Chr8L:29094508..29094532 21/25 Antisense off-target XB22063314.S
Chr8L:29094508..29094532 21/25 Antisense off-target LOC121393141
Chr8L:29186735..29186759 21/25 Antisense off-target LOC108704510
tropicalis 10.0 Chr7:25602631..25602655 22/25 Antisense target hhex
Publications
First: Xhex-expressing endodermal tissues are essential for anterior patterning in Xenopus., Mech Dev 2002              
Most recent: Homeoprotein hhex-induced conversion of intestinal to ventral pancreatic precursors results in the formation of giant pancreata in Xenopus embryos., Proc Natl Acad Sci U S A 2012                                
View All Papers