Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249704

Morpholino Name: h3c8 MO1
Synonyms: H3, hist1h3g MO1
Target mRNA: h3c8

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' CGGTCTGTTTAGTACGAGCCATAGC 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 22/25
genome
MO
5' ACAATGGCTCGTACTAAGCAGACCG 3'
    | |||||||||||||| |||||||
3' CGATACCGAGCATGATTTGTCTGGC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr5S:6159795..6159819 22/25 Antisense target h3c8.S
Chr5L:23908053..23908077 25/25 Antisense off-target LOC108716540
Chr5L:23950851..23950875 25/25 Antisense off-target LOC121393613
Chr5L:23965732..23965756 25/25 Antisense off-target LOC108705669
Chr5L:23994632..23994656 25/25 Antisense off-target LOC108705672
Chr9_10L:134318611..134318635 24/25 Antisense off-target LOC121398066
Chr9_10L:134388304..134388328 24/25 Antisense off-target LOC121398063
Chr9_10L:134394364..134394388 24/25 Antisense off-target LOC108716541
Chr9_10L:134546239..134546263 24/25 Antisense off-target LOC121398064
Chr9_10L:134559425..134559449 24/25 Antisense off-target LOC121398064
Chr9_10S:114184882..114184906 23/25 Antisense off-target LOC121399124
Chr9_10S:114185282..114185306 23/25 Antisense off-target LOC121399123
Chr9_10S:114510050..114510074 22/25 Antisense off-target XB5772961.L
Chr5S:6754872..6754896 22/25 Antisense off-target LOC108717648
Chr5S:6767969..6767993 22/25 Antisense off-target LOC121394151
Chr6S:2325762..2325786 22/25 Sense off-target LOC108695504
Chr5S:6754872..6754896 22/25 Antisense off-target LOC121394152
Chr6S:2325762..2325786 22/25 Antisense off-target LOC108695575
Chr9_10S:114510050..114510074 22/25 Sense off-target LOC108704314
Chr9_10S:114510050..114510074 22/25 Antisense off-target LOC108704296
Chr4L:84823912..84823936 21/25 Sense off-target artn.L
Chr3S:124252902..124252926 21/25 Antisense off-target LOC121402271
Chr9_10L:134989798..134989822 21/25 Antisense off-target LOC121398065
Chr9_10L:135155761..135155785 21/25 Sense off-target LOC108703790
Chr9_10S:114097540..114097564 21/25 Antisense off-target LOC108704306
Chr5L:23892300..23892324 25/25 unknown
Chr5L:24026393..24026417 25/25 unknown
Chr3S:123419795..123419819 21/25 unknown
Chr3S:123433390..123433414 21/25 unknown
Chr3S:123454431..123454455 21/25 unknown
Chr9_10L:135020994..135021018 21/25 unknown
Chr9_10L:135139648..135139672 21/25 unknown
tropicalis 10.0 Chr3:135234033..135234057 23/25 Antisense off-target h3c14
Chr3:135488062..135488086 23/25 Antisense off-target LOC108646286
Chr3:135506146..135506170 23/25 Antisense off-target LOC100496129
Chr3:135612778..135612802 23/25 Antisense off-target LOC116409812
Chr3:135618392..135618416 23/25 Antisense off-target LOC116409811
Chr3:135653765..135653789 23/25 Antisense off-target LOC100495338
Chr3:135661765..135661789 23/25 Antisense off-target LOC100493041
Chr3:135763487..135763511 23/25 Antisense off-target LOC100495788
Chr3:135383979..135384003 23/25 Antisense off-target LOC108646287
Chr3:135396652..135396676 23/25 Antisense off-target LOC116409810
Chr3:135488062..135488086 23/25 Sense off-target LOC101734776
Chr3:135383979..135384003 23/25 Sense off-target LOC100493093
Chr6:4062804..4062828 21/25 Antisense off-target LOC100487179
Chr3:135252765..135252789 23/25 unknown
Publications
First: A developmental requirement for HIRA-dependent H3.3 deposition revealed at gastrulation in Xenopus., Cell Rep 2012                                        
Most recent:
View All Papers