Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249705

Morpholino Name: h2ax MO1
Synonyms: XH2AX-MO, h2ax, hist2h2ab MO1
Target mRNA: h2ax

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TGACGGCTTTTCCTCTGCCCGACAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 23/25 25/25
genome
MO
5' ATGTCTGGCAGAGGAAAGGCAGTCA 3'
   ||||| ||||||||||| || ||||
3' TACAGCCCGTCTCCTTTTCGGCAGT 5'
5' ATGTCTGGCAGAGGAAAAGCAGTCA 3'
   ||||| |||||||||||||| ||||
3' TACAGCCCGTCTCCTTTTCGGCAGT 5'
5' ATGTCGGGCAGAGGAAAAGCCGTCA 3'
   |||||||||||||||||||||||||
3' TACAGCCCGTCTCCTTTTCGGCAGT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7S:70070151..70070175 25/25 Antisense target h2ax.S
Chr7L:82258041..82258065 23/25 Antisense target h2ax.L
Chr5L:161944265..161944289 22/25 Sense off-target zmcm3.L
Chr5S:136847705..136847729 22/25 unknown
tropicalis 10.0 Chr7:80655940..80655964 22/25 Antisense target h2ax
Chr7:80655940..80655964 22/25 Sense off-target foxr1
Publications
First: Histone XH2AX is required for Xenopus anterior neural development: critical role of threonine 16 phosphorylation., J Biol Chem 2010                    
Most recent:
View All Papers