Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249709

Morpholino Name: hmgb3 MO2
Synonyms: 26E1.1moB
Target mRNA: hmgb3

Morpholino Type: uncategorized morpholino
Sequence: 5' CTTCACTCTGTATTGTTCGCTAAGT 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
tropicalis 10.0 Chr1:165746886..165746910 21/25 Sense off-target srrm4
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers