Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249710

Morpholino Name: hmgb3 MO3
Synonyms: 26E1.1moA
Target mRNA: hmgb3

Morpholino Type: uncategorized morpholino
Sequence: 5' GTCACCTTTAGCCATCTTCACTCTG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 23/25 22/25
genome
MO
5' TAGAGTGAAGATGGCTAAAGGTGAC 3'
    ||||||||||||||||||||||||
3' GTCTCACTTCTACCGATTTCCACTG 5'
5' TAGAGTAAAGATGGCTAAAGGTGAC 3'
    ||||| ||||||||||||||||||
3' GTCTCACTTCTACCGATTTCCACTG 5'
5' AAGAGTAAAGATGGCTAAACGTGAC 3'
    ||||| |||||||||||| |||||
3' GTCTCACTTCTACCGATTTCCACTG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:49899625..49899649 23/25 Antisense target hmgb3.L
Chr8S:66589127..66589151 22/25 Antisense target hmgb3.S
Chr4S:94165486..94165510 22/25 Sense off-target rbfox2.S
tropicalis 10.0 Chr8:58157990..58158014 24/25 Antisense target hmgb3
Chr1:20029020..20029044 21/25 unknown
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers