Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249755

Morpholino Name: vepp1 MO1
Synonyms: vpp1 MO1
Target mRNA: vepp1

Morpholino Type: splice blocking morpholino
Sequence: 5' CCTCACCTGAAATGTGGGACAGACA 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' TGTCTGTCCCACATTTCAGGTGAGG 3'
   |||||||||||||||||||||||||
3' ACAGACAGGGTGTAAAGTCCACTCC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:2508179..2508203 25/25 Antisense target vepp1.L
Chr1L:11132475..11132499 21/25 Antisense off-target cdc25b.L
Publications
First: Homeoprotein hhex-induced conversion of intestinal to ventral pancreatic precursors results in the formation of giant pancreata in Xenopus embryos., Proc Natl Acad Sci U S A 2012                                
Most recent:
View All Papers