Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249803

Morpholino Name: elapor2 MO1
Synonyms: kiaa1324l MO1, xEIG121L Moalpha
Target mRNA: elapor2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' ATCCACTCCAGCAGAAAACCCCCAT 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 25/25 23/25
genome
MO
5' ATGGGGGTTTTCTGCTGGAGTGGAT 3'
   |||||||||||||||||||||||||
3' TACCCCCAAAAGACGACCTCACCTA 5'
5' ATGGGGTTTTTCTGCTGGAGCGGAT 3'
   |||||| ||||||||||||| ||||
3' TACCCCCAAAAGACGACCTCACCTA 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:87071528..87071552 25/25 Antisense target elapor2.L
Chr3S:69902144..69902168 23/25 Antisense target elapor2.S
Chr4L:54989210..54989234 21/25 Antisense off-target nfat5.L
tropicalis 10.0 Chr3:81163116..81163140 23/25 Antisense off-target kiaa1324l
Chr5:19627948..19627972 21/25 Antisense off-target prkce
Publications
First: A transmembrane protein EIG121L is required for epidermal differentiation during early embryonic development., J Biol Chem 2011  
Most recent:
View All Papers