Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249804

Morpholino Name: elapor2 MO2
Synonyms: kiaa1324l MO2, xEIG121L MObeta
Target mRNA: elapor2

Morpholino Type: translation blocking morpholino (ATG)
Sequence: 5' TCCGCTCCAGCAGAAAAACCCCATC 3'

Source: Gene Tools LLC


Target mRNA laevis.L laevis.S
Identities 23/25 25/25
genome
MO
5' GATGGGGGTTTTCTGCTGGAGTGGA 3'
   ||||||| ||||||||||||| |||
3' CTACCCCAAAAAGACGACCTCGCCT 5'
5' GATGGGGTTTTTCTGCTGGAGCGGA 3'
   |||||||||||||||||||||||||
3' CTACCCCAAAAAGACGACCTCGCCT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:69902143..69902167 25/25 Antisense target elapor2.S
Chr3L:87071529..87071553 23/25 Antisense target elapor2.L
Chr1S:164402505..164402529 21/25 Antisense off-target chd1.S
tropicalis 10.0 Chr3:81163117..81163141 23/25 Antisense off-target kiaa1324l
Publications
First: A transmembrane protein EIG121L is required for epidermal differentiation during early embryonic development., J Biol Chem 2011  
Most recent:
View All Papers