Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249867

Morpholino Name: magoh MO2
Synonyms: 26A10.2moB
Target mRNA: magoh

Morpholino Type: uncategorized morpholino
Sequence: 5' TGTTACCGGTCGCGCTACTGTATGA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 25/25 23/25
genome
MO
5' TCATACAGTAGCGCGACCGGTAACA 3'
   |||||||||||||||||||||||||
3' AGTATGTCATCGCGCTGGCCATTGT 5'
5' TCATACAGCACCGCGACCGGTAACA 3'
   |||||||| | ||||||||||||||
3' AGTATGTCATCGCGCTGGCCATTGT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr4L:92480886..92480910 23/25 Antisense target magoh.L
tropicalis 10.0 Chr4:97133105..97133129 25/25 Antisense target magoh
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers