Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249874

Morpholino Name: mapk8 MO1
Synonyms: JNK MO, JNK1, Xdsh-MO, xJNK
Target mRNA: mapk8

Morpholino Type: uncategorized morpholino
Sequence: 5' TGCTGTCACGCTTGCTTCGGCTCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' ATGAGCCGAAGCAAGCGTGACAGCA 3'
   |||||||||||||||||||||||||
3' TACTCGGCTTCGTTCGCACTGTCGT 5'
5' ATGAGCCGAAGCAAGCGTGACAGCA 3'
   |||||||||||||||||||||||||
3' TACTCGGCTTCGTTCGCACTGTCGT 5'
5' ATGAGCCGAAGCAAGCGTGACAGCA 3'
   |||||||||||||||||||||||||
3' TACTCGGCTTCGTTCGCACTGTCGT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:64951312..64951336 25/25 Antisense target mapk8.L
Chr7S:50498281..50498305 25/25 Antisense target mapk8.S
tropicalis 10.0 Chr7:61782920..61782944 25/25 Antisense target mapk8
Publications
First: JNK functions in the non-canonical Wnt pathway to regulate convergent extension movements in vertebrates., EMBO Rep 2002  
Most recent: Role of JNK during buccopharyngeal membrane perforation, the last step of embryonic mouth formation., Dev Dyn 2017              
View All Papers