Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249954

Morpholino Name: n4bp3 MO1
Synonyms: n4bp3 MO
Target mRNA: n4bp3

Morpholino Type: uncategorized morpholino
Sequence: 5' CAATCAGGCTGCTTACACTTCCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 23/25
genome
MO
5' ATGGGAAGTGTAAGCAGCCTAATTG 3'
   |||||||||||||||||||| ||||
3' TACCCTTCACATTCGTCGGACTAAC 5'
5' ATGGGAAGTGTAAGCAGCCTGATTG 3'
   |||||||||||||||||||||||||
3' TACCCTTCACATTCGTCGGACTAAC 5'
5' ATGGGAAATGTAAGCAGCCTGATGG 3'
   ||||||| ||||||||||||||| |
3' TACCCTTCACATTCGTCGGACTAAC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:55104840..55104864 25/25 Antisense target n4bp3.L
Chr3S:99293181..99293205 23/25 Antisense target n4bp3.S
Chr9_10S:55377401..55377425 21/25 Sense off-target thsd7b.S
Chr9_10L:123490252..123490276 21/25 Sense off-target LOC108701700
tropicalis 10.0 Chr3:47790651..47790675 24/25 Antisense target n4bp3
Chr10:47440805..47440829 21/25 Antisense off-target dnah9
Chr3:7223439..7223463 21/25 Sense off-target large1
Publications
First: The Nedd4-binding protein 3 (N4BP3) is crucial for axonal and dendritic branching in developing neurons., Neural Dev 2013                      
Most recent: The Nedd4 binding protein 3 is required for anterior neural development in Xenopus laevis., Dev Biol 2017                              
View All Papers