Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249955

Morpholino Name: naca.2 MO1
Synonyms: 24B12.1moA
Target mRNA: naca

Morpholino Type: uncategorized morpholino
Sequence: 5' AGCTGGGACAGTTTCTGTGGCTTCA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' TGAAGCCACAGAAACTGTCCCAGCT 3'
   |||||||||||||||||||||||||
3' ACTTCGGTGTCTTTGACAGGGTCGA 5'
5' TGAAGCCACAGAAACTGTCCCAGCT 3'
   |||||||||||||||||||||||||
3' ACTTCGGTGTCTTTGACAGGGTCGA 5'
5' TGAAGCCACAGAAACTGTCCCAGCT 3'
   |||||||||||||||||||||||||
3' ACTTCGGTGTCTTTGACAGGGTCGA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2L:145861494..145861518 25/25 Antisense target naca.L
Chr2S:130411310..130411334 25/25 Antisense target naca.S
Chr2S:106547790..106547814 21/25 Antisense off-target tfdp1.S
Chr1L:104507607..104507631 21/25 Sense off-target LOC108712232
Chr2L:117992147..117992171 21/25 Antisense off-target LOC108708431
Chr3L:16470939..16470963 21/25 Antisense off-target LOC108710184
Chr3S:43720769..43720793 21/25 Sense off-target LOC108712840
Chr4S:78120513..78120537 21/25 Sense off-target LOC108715624
Chr5S:12254242..12254266 21/25 Antisense off-target LOC108717691
Chr1L:131784205..131784229 21/25 unknown
Chr1S:14267621..14267645 21/25 unknown
Chr2L:7481210..7481234 21/25 unknown
Chr5S:122883375..122883399 21/25 unknown
Chr5S:122887375..122887399 21/25 unknown
Chr9_10S:85552862..85552886 21/25 unknown
Chr5L:156171084..156171108 21/25 unknown
tropicalis 10.0 Chr2:138806630..138806654 25/25 Antisense target naca
Publications
First: Pilot morpholino screen in Xenopus tropicalis identifies a novel gene involved in head development., Dev Dyn 2004          
Most recent:
View All Papers