Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249956

Morpholino Name: nanos1 MO1
Synonyms:
Target mRNA: nanos1

Morpholino Type: uncategorized morpholino
Sequence: 5' CGCCATCCATGTTGGAATTGTTCTG 3'

Source: Gene Tools LLC


Target mRNA laevis.L
Identities 25/25
genome
MO
5' CAGAACAATTCCAACATGGATGGCG 3'
   |||||||||||||||||||||||||
3' GTCTTGTTAAGGTTGTACCTACCGC 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:4837542..4837566 25/25 Antisense target nanos1.L
tropicalis 10.0 Chr5:17983802..17983826 21/25 unknown
Publications
First: Xenopus Nanos1 is required to prevent endoderm gene expression and apoptosis in primordial germ cells., Development 2012                  
Most recent:
View All Papers