Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249957

Morpholino Name: nap1l1 MO1
Synonyms: xNAP1L morpholino
Target mRNA: nap1l1

Morpholino Type: uncategorized morpholino
Sequence: 5' TATGTTAGCCATTATGTTGAGCACC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 22/25 23/25
genome
MO
5' GGTGCTGAACAGAATGGCTAACATA 3'
   |||||| |||| |||||||||||||
3' CCACGAGTTGTATTACCGATTGTAT 5'
5' GGTGCTGAATAAAATGGCTAACATA 3'
   |||||| || | |||||||||||||
3' CCACGAGTTGTATTACCGATTGTAT 5'
5' GGTGCTGAACATAATGGCTACCATA 3'
   |||||| ||||||||||||| ||||
3' CCACGAGTTGTATTACCGATTGTAT 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:86809464..86809488 23/25 Antisense target nap1l1.S
Chr3L:68096188..68096212 22/25 Antisense target nap1l1.L
tropicalis 10.0 Chr3:61251309..61251333 23/25 Antisense target nap1l1
Publications
First: Zygotic nucleosome assembly protein-like 1 has a specific, non-cell autonomous role in hematopoiesis., Blood 2005  
Most recent: Identification of a structural and functional domain in xNAP1 involved in protein-protein interactions., Nucleic Acids Res 2006              
View All Papers