Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249958

Morpholino Name: ncam1 MO1
Synonyms: NCAM
Target mRNA: ncam1

Morpholino Type: uncategorized morpholino
Sequence: 5' AGATGAGATCCTTAATGTGCAGCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 24/25 25/25 25/25
genome
MO
5' ATGCTGCAAATTAAGGATCTCATCT 3'
   |||||||| ||||||||||||||||
3' TACGACGTGTAATTCCTAGAGTAGA 5'
5' ATGCTGCACATTAAGGATCTCATCT 3'
   |||||||||||||||||||||||||
3' TACGACGTGTAATTCCTAGAGTAGA 5'
5' ATGCTGCACATTAAGGATCTCATCT 3'
   |||||||||||||||||||||||||
3' TACGACGTGTAATTCCTAGAGTAGA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:88848968..88848992 25/25 Antisense target ncam1.L
Chr7S:75396622..75396646 25/25 Antisense target ncam1.S
Chr6L:55304009..55304033 22/25 Sense off-target LOC108718965
Chr5L:135056547..135056571 21/25 Sense off-target farp2.L
Chr8S:100969961..100969985 21/25 Antisense off-target pcp4l1.S
Chr6S:45734908..45734932 21/25 Sense off-target LOC108719989
tropicalis 10.0 Chr7:86743176..86743200 24/25 Antisense target ncam1
Chr1:39107854..39107878 21/25 Antisense off-target fryl
Chr7:25344925..25344949 21/25 Sense off-target exoc6
Chr6:52781882..52781906 21/25 Sense off-target tmem108
Publications
First: Retinal patterning by Pax6-dependent cell adhesion molecules., Dev Neurobiol 2010                  
Most recent:
View All Papers