Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249959

Morpholino Name: ncor2 MO1
Synonyms: X.tropicalis exon 37b splice donor
Target mRNA: ncor2

Morpholino Type: uncategorized morpholino
Sequence: 5' GTATGTCTTACCATCACTATTGGCG 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.S
Identities 25/25 25/25
genome
MO
5' CGCCAATAGTGATGGTAAGACATAC 3'
   |||||||||||||||||||||||||
3' GCGGTTATCACTACCATTCTGTATG 5'
5' CGCCAATAGTGATGGTAAGACATAC 3'
   |||||||||||||||||||||||||
3' GCGGTTATCACTACCATTCTGTATG 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr1S:149184998..149185022 25/25 Antisense target ncor2.S
Chr1L:174297101..174297125 23/25 Antisense off-target LOC398642
tropicalis 10.0 Chr1:160545784..160545808 25/25 Antisense target ncor2
Publications
First: Xenopus embryos lacking specific isoforms of the corepressor SMRT develop abnormal heads., Dev Biol 2006                      
Most recent:
View All Papers