Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249960

Morpholino Name: ndp MO1
Synonyms: xNor-MO
Target mRNA: ndp

Morpholino Type: uncategorized morpholino
Sequence: 5' CTCAATCCCAGTCTTCCTTTCAGGT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 23/25 25/25
genome
MO
5' ACCTGAGAGGAAGACTGGGATTAAG 3'
   |||||| ||||||||||||||| ||
3' TGGACTTTCCTTCTGACCCTAACTC 5'
5' ACCTAAAAGGAAAACTGGGATTGAG 3'
   |||| ||||||| ||||||||||||
3' TGGACTTTCCTTCTGACCCTAACTC 5'
5' ACCTGAAAGGAAGACTGGGATTGAG 3'
   |||||||||||||||||||||||||
3' TGGACTTTCCTTCTGACCCTAACTC 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:48161574..48161598 25/25 Antisense target ndp.S
Chr2L:83025276..83025300 23/25 Antisense target ndp.L
Chr3S:59360746..59360770 21/25 Antisense off-target csk.S
Chr8S:28150324..28150348 21/25 Sense off-target LOC108699894
Chr2L:76992494..76992518 22/25 unknown
tropicalis 10.0 Chr2:56015285..56015309 23/25 Antisense target ndp
Chr6:89519450..89519474 23/25 unknown
Chr10:7236..7260 22/25 unknown
Chr9:54434672..54434696 22/25 unknown
Chr2:44348673..44348697 21/25 unknown
Publications
First: Maternal xNorrin, a canonical Wnt signaling agonist and TGF-β antagonist, controls early neuroectoderm specification in Xenopus., PLoS Biol 2012                                      
Most recent:
View All Papers