Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249961

Morpholino Name: ndp MO2
Synonyms: Xnore-spMO, xNor-spMO
Target mRNA: ndp

Morpholino Type: uncategorized morpholino
Sequence: 5' TTAAAGTGGACTGTACCTTGGCAGT 3'

Source: Gene Tools LLC


Target mRNA laevis.S
Identities 25/25
genome
MO
5' ACTGCCAAGGTACAGTCCACTTTAA 3'
   |||||||||||||||||||||||||
3' TGACGGTTCCATGTCAGGTGAAATT 5'
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr2S:48161817..48161841 25/25 Antisense target ndp.S
Chr9_10L:64154607..64154631 21/25 unknown
tropicalis 10.0 Chr1:115932002..115932026 22/25 Antisense off-target svep1
Chr8:105320315..105320339 21/25 Antisense off-target tmem151b
Chr5:10790316..10790340 21/25 unknown
Chr7:49004713..49004737 21/25 unknown
Publications
First: Maternal xNorrin, a canonical Wnt signaling agonist and TGF-β antagonist, controls early neuroectoderm specification in Xenopus., PLoS Biol 2012                                      
Most recent:
View All Papers