Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249962

Morpholino Name: ndrg1 MO1
Synonyms: ndrg1a MO2
Target mRNA: ndrg1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATACCCTGGTGTCCTGATGCTGCGC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 23/25 25/25 21/25
genome
MO
5' GCGCAGCATCAGGACACCAGGATAC 3'
   ||||||||||||||||||||| || 
3' CGCGTCGTAGTCCTGTGGTCCCATA 5'
5' GCGCAGCATCAGGACACCAGGGTAT 3'
   |||||||||||||||||||||||||
3' CGCGTCGTAGTCCTGTGGTCCCATA 5'
5' GCGCAGCAACAGGACACCAGCGTGC 3'
   |||||||| ||||||||||| ||  
3' CGCGTCGTAGTCCTGTGGTCCCATA 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:154891084..154891108 25/25 Antisense target ndrg1.L
Chr6S:129760022..129760046 21/25 Antisense target ndrg1.S
Chr8L:90103795..90103819 21/25 unknown
tropicalis 10.0 Chr6:143704682..143704706 23/25 Antisense target ndrg1
Publications
First: Retinoic acid-activated Ndrg1a represses Wnt/β-catenin signaling to allow Xenopus pancreas, oesophagus, stomach, and duodenum specification., PLoS One 2013                    
Most recent:
View All Papers