Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249963

Morpholino Name: ndrg1 MO2
Synonyms: ndrg1a MO1
Target mRNA: ndrg1

Morpholino Type: uncategorized morpholino
Sequence: 5' ATAGCCGTTTGCCTGTGTAAGAAGA 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:27767071..27767095 21/25 Antisense off-target LOC108710830
Publications
First: Retinoic acid-activated Ndrg1a represses Wnt/β-catenin signaling to allow Xenopus pancreas, oesophagus, stomach, and duodenum specification., PLoS One 2013                    
Most recent:
View All Papers