Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249964

Morpholino Name: ndrg1 MO3
Synonyms: xNDRG1-MO
Target mRNA: ndrg1

Morpholino Type: uncategorized morpholino
Sequence: 5' GTTCAGCTTGGGCGTCCCACACATA 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 25/25 25/25 25/25
genome
MO
5' TATGTGTGGGACGCCCAAGCTGAAC 3'
   |||||||||||||||||||||||||
3' ATACACACCCTGCGGGTTCGACTTG 5'
5' TATGTGTGGGACGCCCAAGCTGAAC 3'
   |||||||||||||||||||||||||
3' ATACACACCCTGCGGGTTCGACTTG 5'
5' TATGTGTGGGACGCCCAAGCTGAAC 3'
   |||||||||||||||||||||||||
3' ATACACACCCTGCGGGTTCGACTTG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr6L:154871681..154871705 25/25 Antisense target ndrg1.L
Chr6S:129727665..129727689 25/25 Antisense target ndrg1.S
tropicalis 10.0 Chr6:143681618..143681642 25/25 Antisense target ndrg1
Publications
First: Identification and characterization of Xenopus NDRG1., Biochem Biophys Res Commun 2003            
Most recent:
View All Papers