Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249966

Morpholino Name: ndufa13 MO2
Synonyms: XGRIM-19 MO2
Target mRNA: ndufa13

Morpholino Type: uncategorized morpholino
Sequence: 5' CCTGTTTCACCTTGGACGCCGCCAT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 24/25 25/25
genome
MO
5' ATGGCGGCGTCCAAGGTGAAGCAGG 3'
   |||||||||||||||||||| ||||
3' TACCGCCGCAGGTTCCACTTTGTCC 5'
5' ATGGCGGCGTCCAAGGTGAAACAGG 3'
   |||||||||||||||||||||||||
3' TACCGCCGCAGGTTCCACTTTGTCC 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr7L:53755218..53755242 25/25 Antisense target ndufa13.L
tropicalis 10.0 Chr7:53119698..53119722 24/25 Antisense target ndufa13
Publications
First: The mitochondrial respiratory chain controls intracellular calcium signaling and NFAT activity essential for heart formation in Xenopus laevis., Mol Cell Biol 2007  
Most recent: Mitochondria and calcium signaling in embryonic development., Semin Cell Dev Biol 2009      
View All Papers