Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249967

Morpholino Name: nedd4l MO1
Synonyms: Nedd4-MO
Target mRNA: nedd4l

Morpholino Type: uncategorized morpholino
Sequence: 5' TACCGCCGACTTGGGTAGATACCTG 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
Publications
First: E3 ligase Nedd4 promotes axon branching by downregulating PTEN., Neuron 2010                    
Most recent:
View All Papers