Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249968

Morpholino Name: nek2 MO1
Synonyms: nek2
Target mRNA: nek2

Morpholino Type: uncategorized morpholino
Sequence: 5' GCATTCTCTGCCCCCGCACGAAATA 3'

Source: Gene Tools LLC


Target mRNA
Identities
genome
MO
     
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr8L:9692395..9692419 21/25 unknown
tropicalis 10.0 Chr5:14881826..14881850 25/25 Antisense off-target LOC100328980
Publications
First: Rare copy number variations in congenital heart disease patients identify unique genes in left-right patterning., Proc Natl Acad Sci U S A 2011                        
Most recent:
View All Papers