Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249969

Morpholino Name: neo1 MO1
Synonyms: Xneog1b-ATG
Target mRNA: neo1

Morpholino Type: uncategorized morpholino
Sequence: 5' TCGGATCGCCATCCCACGCCTATTC 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L
Identities 23/25 23/25
genome
MO
5' GAAAAGGTGTGGGATGGCGATCCGA 3'
   ||| ||| |||||||||||||||||
3' CTTATCCGCACCCTACCGCTAGGCT 5'
5' GAAAAGGTGTGGGATGGCGATCCGA 3'
   ||| ||| |||||||||||||||||
3' CTTATCCGCACCCTACCGCTAGGCT 5'
    
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3L:97847579..97847603 23/25 Antisense target neo1.L
tropicalis 10.0 Chr3:92276118..92276142 23/25 Antisense target neo1
Publications
First: Neogenin and RGMa control neural tube closure and neuroepithelial morphology by regulating cell polarity., J Neurosci 2008                  
Most recent:
View All Papers