Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.

Summary Attributions Wiki
XB-MORPHOLINO-17249970

Morpholino Name: neo1 MO2
Synonyms: Neo1, Xneog1a-ATG
Target mRNA: neo1

Morpholino Type: uncategorized morpholino
Sequence: 5' GACTTCGGACTGCCATCCCACACCT 3'

Source: Gene Tools LLC


Target mRNA tropicalis laevis.L laevis.S
Identities 22/25 21/25 22/25
genome
MO
5' AGGTGTGGGATGGCGATCCGAAGCC 3'
   ||||||||||||||  ||||||| |
3' TCCACACCCTACCGTCAGGCTTCAG 5'
5' AGGTGTGGGATGGCGATCCGAGGCC 3'
   ||||||||||||||  ||||| | |
3' TCCACACCCTACCGTCAGGCTTCAG 5'
5' AGGTGTGGGATGGCCATCCGAAGCC 3'
   ||||||||||||||  ||||||| |
3' TCCACACCCTACCGTCAGGCTTCAG 5'
   
Genomic Alignments Position Identity Strand Target Target mRNA
laevis 10.1 Chr3S:60818990..60819014 22/25 Antisense target neo1.S
Chr3L:97847583..97847607 21/25 Antisense target neo1.L
tropicalis 10.0 Chr3:92276122..92276146 22/25 Antisense target neo1
Publications
First: Neogenin interacts with RGMa and netrin-1 to guide axons within the embryonic vertebrate forebrain., Dev Biol 2006                        
Most recent: Novel roles of the chemorepellent axon guidance molecule RGMa in cell migration and adhesion., Mol Cell Biol 2012  
View All Papers